MirGeneDB

Gene name

Pmi-Mir-29-P1

Family name MIR-29 (all species)
Species Bat starfish (Patiria miniata)
MiRBase ID pmi-mir-29b
Paralogues Pmi-Mir-29-P2 
Orthologues Aae-Mir-29-P1d  Aca-Mir-29-P1a  Aca-Mir-29-P1b  Ami-Mir-29-P1a  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bge-Mir-29-P1c  Bge-Mir-29-P1d  Bta-Mir-29-P1a  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cli-Mir-29-P1b  Cpi-Mir-29-P1a  Cpi-Mir-29-P1b  Cpo-Mir-29-P1a  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dan-Mir-29-P1c  Dan-Mir-29-P1d  Dme-Mir-29-P1c  Dme-Mir-29-P1d  Dmo-Mir-29-P1c  Dmo-Mir-29-P1d  Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dpu-Mir-29-P1c  Dpu-Mir-29-P1d  Dre-Mir-29-P1a1  Efe-Mir-29-P1e  Efe-Mir-29-P1f  Ete-Mir-29-P1a  Ete-Mir-29-P1b  Gga-Mir-29-P1a  Gga-Mir-29-P1b  Hme-Mir-29-P1d  Hsa-Mir-29-P1a  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lan-Mir-29-P1g  Lan-Mir-29-P1h  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mdo-Mir-29-P1b  Mml-Mir-29-P1a  Mml-Mir-29-P1b  Mmu-Mir-29-P1a  Mmu-Mir-29-P1b  Oan-Mir-29-P1a  Oan-Mir-29-P1b  Ocu-Mir-29-P1a  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Rno-Mir-29-P1a  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1a  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1a  Sto-Mir-29-P1b  Tca-Mir-29-P1c  Tca-Mir-29-P1d  Tgu-Mir-29-P1a  Tgu-Mir-29-P1b  Xtr-Mir-29-P1a  Xtr-Mir-29-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pmin1)
JH769952.1: 63311-63374 [-]
Clustered MiRNAs
(< 10kb from Mir-29-P1)
Mir-29-P2 JH769952.1: 66752-66814 [-]
Precursor
(pre-Mir +30nt flank)
AGUUCUGAGGAAAUAAUGCCAAUCCCGAAAACUGUUUUUUCUUGGUGCUUAGAGUCCUUCUUUUUUGUCGUCUAGCACCAUGAAAAAGCAGUCUUUGUGGUUGGUAUGUACAUGUAAAAGCUAA
Get precursor sequence
Structure
        10          20        30        40        50        60  
AGUUCUGAGGAAAUAAU--|      C    A           U       U   GUCCUUCU 
                   GCCAAUC CGAA ACUGUUUUUUC UGGUGCU AGA        \
                   UGGUUGG GUUU UGACGAAAAAG ACCACGA UCU        U
AAUCGAAAAUGUACAUGUA^      U    C           U       -   GCUGUUUU 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Em To
Star sequence

Pmi-Mir-29-P1_5p*

MirBase accessionNone
Sequence
0- ACUGUUUUUUCUUGGUGCUUAGA -23
Get sequence
Mature sequence

Pmi-Mir-29-P1_3p

MirBase accessionMIMAT0032146
Sequence
42- UAGCACCAUGAAAAAGCAGUCU -64
Get sequence
Seed sequenceAGCACCA