MirGeneDB

MirGeneDB ID

Asu-Mir-29-P2

Family name MIR-29 (all species)
Seed AGCACCA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-49
Paralogues Asu-Mir-29-P1 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2a  Aca-Mir-29-P2b-v1  Aca-Mir-29-P2b-v2  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Ami-Mir-29-P2b-v1  Ami-Mir-29-P2b-v2  Bfl-Mir-29-P2  Bge-Mir-29-P2e  Bge-Mir-29-P2f  Bta-Mir-29-P2a  Bta-Mir-29-P2b5  Bta-Mir-29-P2b6  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cfa-Mir-29-P2b-v1  Cfa-Mir-29-P2b-v2  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cli-Mir-29-P2b-v1  Cli-Mir-29-P2b-v2  Cpi-Mir-29-P2a  Cpi-Mir-29-P2b-v1  Cpi-Mir-29-P2b-v2  Cpo-Mir-29-P2a  Cpo-Mir-29-P2b  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2a  Dno-Mir-29-P2b-v1  Dno-Mir-29-P2b-v2  Dre-Mir-29-P2a  Dre-Mir-29-P2b1  Dre-Mir-29-P2b2  Efe-Mir-29-P2c  Efe-Mir-29-P2d  Ete-Mir-29-P2a  Ete-Mir-29-P2b-v1  Ete-Mir-29-P2b-v2  Gga-Mir-29-P2a  Gga-Mir-29-P2b-v1  Gga-Mir-29-P2b-v2  Hme-Mir-29-P2  Hsa-Mir-29-P2a  Hsa-Mir-29-P2b-v1  Hsa-Mir-29-P2b-v2  Lan-Mir-29-P2g  Lan-Mir-29-P2h  Mdo-Mir-29-P2a  Mdo-Mir-29-P2b-v1  Mdo-Mir-29-P2b-v2  Mml-Mir-29-P2a  Mml-Mir-29-P2b-v1  Mml-Mir-29-P2b-v2  Mmu-Mir-29-P2a  Mmu-Mir-29-P2b  Oan-Mir-29-P2a  Oan-Mir-29-P2b-v1  Oan-Mir-29-P2b-v2  Ocu-Mir-29-P2a  Ocu-Mir-29-P2b  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2a  Rno-Mir-29-P2b3  Rno-Mir-29-P2b4  Sha-Mir-29-P2a  Sha-Mir-29-P2b-v1  Sha-Mir-29-P2b-v2  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2a  Sto-Mir-29-P2b  Tca-Mir-29-P2  Tgu-Mir-29-P2a  Tgu-Mir-29-P2b-v1  Tgu-Mir-29-P2b-v2  Xtr-Mir-29-P2a  Xtr-Mir-29-P2b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold406: 250649-250708 [-]
Precursor
(pre-Mir +30nt flank)
UUCUCUGGUCCUUAGUUUCGCUGCGCGGUGCGUAGUUUCAUAUGGGUAUGCUCCGUUGUGUAUUUUCGAAGCACCAUGUGAAGCUGCUAUCCGAACGGCGAUAUGAUUAUCUCAGUUCCC
Get precursor sequence
Structure
        10          20        30        40        50        60 
UUCUCUGGUCCUUAGUU--|     CG   UGC              GUA    C  UUGUG 
                   UCGCUG  CGG   GUAGUUUCAUAUGG   UGCU CG     \
                   AGCGGC  GCC   CGUCGAAGUGUACC   ACGA GC     U
CCCUUGACUCUAUUAGUAU^     AA   UAU              ---    A  UUUUA 
.       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-29-P2_5p*

MirBase accessionMIMAT0021459
Sequence
0- CGUAGUUUCAUAUGGGUAUGCUCCG -25
Get sequence
Mature sequence

Asu-Mir-29-P2_3p

MirBase accessionMIMAT0021460
Sequence
38- AAGCACCAUGUGAAGCUGCUAU -60
Get sequence