MirGeneDB

Gene name

Sko-Mir-29-P1

Family name MIR-29 (all species)
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-29a
Paralogues Sko-Mir-29-P2 
Orthologues Aae-Mir-29-P1d  Aca-Mir-29-P1a  Aca-Mir-29-P1b  Ami-Mir-29-P1a  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bge-Mir-29-P1c  Bge-Mir-29-P1d  Bta-Mir-29-P1a  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cli-Mir-29-P1b  Cpi-Mir-29-P1a  Cpi-Mir-29-P1b  Cpo-Mir-29-P1a  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dan-Mir-29-P1c  Dan-Mir-29-P1d  Dme-Mir-29-P1c  Dme-Mir-29-P1d  Dmo-Mir-29-P1c  Dmo-Mir-29-P1d  Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dpu-Mir-29-P1c  Dpu-Mir-29-P1d  Dre-Mir-29-P1a1  Efe-Mir-29-P1e  Efe-Mir-29-P1f  Ete-Mir-29-P1a  Ete-Mir-29-P1b  Gga-Mir-29-P1a  Gga-Mir-29-P1b  Hme-Mir-29-P1d  Hsa-Mir-29-P1a  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lan-Mir-29-P1g  Lan-Mir-29-P1h  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mdo-Mir-29-P1b  Mml-Mir-29-P1a  Mml-Mir-29-P1b  Mmu-Mir-29-P1a  Mmu-Mir-29-P1b  Oan-Mir-29-P1a  Oan-Mir-29-P1b  Ocu-Mir-29-P1a  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1a  Sha-Mir-29-P1b  Spu-Mir-29-P1  Sto-Mir-29-P1a  Sto-Mir-29-P1b  Tca-Mir-29-P1c  Tca-Mir-29-P1d  Tgu-Mir-29-P1a  Tgu-Mir-29-P1b  Xtr-Mir-29-P1a  Xtr-Mir-29-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Skow_1.1)
NW_003113965.1: 294704-294763 [+]
Precursor
(pre-Mir +30nt flank)
CUUUGAAUAGAAUGUUGUUAUAAUGGGAGACUGGCUUUAUUUGGUGCAUGGAGUACACUUUCAUCCUCUAGCACCAUAUGAAAUCAGUUUUCCAUAGUGACAUUAUCAGCUUUAUUGGUG
Get precursor sequence
Structure
        10           20        30        40        50         
CUUUGAAUAGAAUGUUG---|   A           GC     U      A    GUACAC 
                    UUAU AUGGGAGACUG  UUUAU UGGUGC UGGA      U
                    AGUG UACCUUUUGAC  AAGUA ACCACG AUCU      U
GUGGUUAUUUCGACUAUUAC^   A           UA     U      -    CCUACU 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sko-Mir-29-P1_5p*

MirBase accessionNone
Sequence
0- CUGGCUUUAUUUGGUGCAUGGA -22
Get sequence
Mature sequence

Sko-Mir-29-P1_3p

MirBase accessionMIMAT0009612
Sequence
38- UAGCACCAUAUGAAAUCAGUUU -60
Get sequence
Seed sequenceAGCACCA