| MirGeneDB ID | Pab-Mir-484 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-484 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Sumatran orangutan (Pongo abelii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-484 Cfa-Mir-484 Cja-Mir-484 Dno-Mir-484 Eca-Mir-484 Hsa-Mir-484 Laf-Mir-484 Mml-Mir-484 Mmr-Mir-484-P1 Mmr-Mir-484-P2 Mmu-Mir-484 Ocu-Mir-484 Rno-Mir-484 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_028885655.2_NHGRI_mPonAbe1-v2.0_traces) |
CM054697.2: 17817573-17817629 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGGCUC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UCCUAUCCGCGCGGGGCACGCUGGGAACCCCGGGGGGGGCGGGGCCUCGCGGCCCUGCAGCCUCGUCAGGCUCAGUCCCCUCCCGAUAAACCCCUAAAUAGGGACUUUCCCGGGGGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UCCUAUCCGCGCGGGGCACGCU-- AACCC -| G C GCCCU GGG CGGG GGGGGC GGGCCU GCG G CCC GCCC CCCCUG CUCGGA UGC C GGGGGGCCCUUUCAGGGAUAAAUC AAAUA U^ A C UCCGA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 3, Kim et al. 2016) Drosha-independent 5' capped miRNA few star reads are cloned and sequenced. Mirbase has the wrong end annoated as the mature arm (Babiarz et al. 2008). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pab-Mir-484_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGGGGGGGCGGGGCCUCGCG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pab-Mir-484_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UCAGGCUCAGUCCCCUCCCGAU -57
Get sequence
|
