| MirGeneDB ID | Cja-Mir-484 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-484 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | White-tufted-ear marmoset (Callithrix jacchus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-484 Cfa-Mir-484 Dno-Mir-484 Eca-Mir-484 Hsa-Mir-484 Laf-Mir-484 Mml-Mir-484 Mmr-Mir-484-P1 Mmr-Mir-484-P2 Mmu-Mir-484 Ocu-Mir-484 Pab-Mir-484 Rno-Mir-484 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_011100555.2_mCalJa1.2.pat.X_genomic) |
CM021926.1: 11306719-11306775 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGGCUC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UCCUCUCCGCGCGGGGCAUGCUGGGAACCCCGGGGGGGGCGGGGCCUCGCGGCCCUGCAGCCUCGUCAGGCUCAGUCCCCUCCCGAUAAACCCCUAAAUAGGGACUUUCCCGGGGAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UCCUCUCCGCGCGGGGCAUGCU-- AACCC -| G C GCCCU GGG CGGG GGGGGC GGGCCU GCG G CCC GCCC CCCCUG CUCGGA UGC C GAGGGGCCCUUUCAGGGAUAAAUC AAAUA U^ A C UCCGA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 3, Kim et al. 2016) Drosha-independent 5' capped miRNA few star reads are cloned and sequenced. Mirbase has the wrong end annoated as the mature arm (Babiarz et al. 2008). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cja-Mir-484_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGGGGGGGCGGGGCCUCGCG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cja-Mir-484_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UCAGGCUCAGUCCCCUCCCGAU -57
Get sequence
|
