| MirGeneDB ID | Mmr-Mir-484-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-484 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Gray mouse lemur (Microcebus murinus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mmr-Mir-484-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-484 Cfa-Mir-484 Cja-Mir-484 Dno-Mir-484 Eca-Mir-484 Hsa-Mir-484 Laf-Mir-484 Mml-Mir-484 Mmu-Mir-484 Ocu-Mir-484 Pab-Mir-484 Rno-Mir-484 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | M. murinus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000165445.3_Mmur_3.0_genomic) |
CM007677.1: 33446500-33446556 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGGCUC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGAAAAGAAUUCCAUUAAAAGAAUAAAAGCUGGGGGGGGCGGGGCCUCGCGGCCCUGCAGCCUCGUCAGGCUCAGUCCCCUCCCGAAAAAAAAAAAAAAAUAAAAAAAAAAAAAAAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AGAAAAGAAUUCCAUUAAAAGAAUAAAAGC-- -| G C GCCCU UGGG GGGGGC GGGCCU GCG G GCCC CCCCUG CUCGGA UGC C AAAAAAAAAAAAAAAAUAAAAAAAAAAAAAAA U^ A C UCCGA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 3, Kim et al. 2016) Drosha-independent 5' capped miRNA few star reads are cloned and sequenced. Mirbase has the wrong end annoated as the mature arm (Babiarz et al. 2008). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mmr-Mir-484-P2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGGGGGGGGCGGGGCCUCGCG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mmr-Mir-484-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UCAGGCUCAGUCCCCUCCCGAA -57
Get sequence
|
