MirGeneDB

MirGeneDB ID

Oan-Mir-430-P53

Family name MIR-430 (all species)
Seed AAGUGCU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-1420a
Paralogues Oan-Mir-430-P1  Oan-Mir-430-P2  Oan-Mir-430-P3  Oan-Mir-430-P4  Oan-Mir-430-P54  Oan-Mir-430-P55  Oan-Mir-430-P56  Oan-Mir-430-P57  Oan-Mir-430-P58  Oan-Mir-430-P59  Oan-Mir-430-P60  Oan-Mir-430-P61 
Orthologues
Node of Origin (locus) O. anatinus
Node of Origin (family) Vertebrata
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041737.1: 54187151-54187209 [+]
Clustered MiRNAs
(< 10kb from Mir-430-P53)
Mir-430-P53 NC_041737.1: 54187151-54187209 [+]
Mir-430-P54 NC_041737.1: 54187300-54187360 [+]
Mir-430-P55 NC_041737.1: 54187861-54187919 [+]
Mir-430-P56 NC_041737.1: 54190035-54190095 [+]
Mir-430-P57 NC_041737.1: 54190187-54190244 [+]
Mir-430-P58 NC_041737.1: 54190481-54190536 [+]
Mir-430-P60 NC_041737.1: 54191452-54191511 [+]
Mir-430-P59 NC_041737.1: 54191591-54191649 [+]
Precursor
(pre-Mir +30nt flank)
GGAGAGAAGCAUCAUUCCCCAUCUUUGUCAAUUCGAUCAGCCUGCACUCUCUGGUUGUGUCAGAAGGAAAGUGCUUCCUGUUCGGAUAAACAGGCUGGGGUGCGGCAACCAGGACCAUC
Get precursor sequence
Structure
        10           20        30        40        50         
GGAGAGAAGCAUCAUUC---|   U   U  CA      U   CCU     C   GGUUGU 
                    CCCA CUU GU  AUUCGA CAG   GCACU UCU      \
                    GGGU GGA CA  UAGGCU GUC   CGUGA AGG      G
CUACCAGGACCAACGGCGUG^   C   -  AA      U   CUU     A   AAGACU 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-430-P53_5p*

MirBase accessionMIMAT0006922
Sequence
0- AUUCGAUCAGCCUGCACUCUCU -22
Get sequence
Mature sequence

Oan-Mir-430-P53_3p

MirBase accessionMIMAT0006923
Sequence
37- AAAGUGCUUCCUGUUCGGAUAA -59
Get sequence