MirGeneDB

MirGeneDB ID

Lgi-Mir-184-P5

Family name MIR-184 (all species)
Seed GGACGGA
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-184
Paralogues Lgi-Mir-184-P6 
Orthologues Aae-Mir-184  Aca-Mir-184  Ami-Mir-184  Asu-Mir-184  Bfl-Mir-184  Bge-Mir-184  Bta-Mir-184  Cfa-Mir-184  Cin-Mir-184  Cli-Mir-184  Cpi-Mir-184  Cpo-Mir-184  Dan-Mir-184  Dme-Mir-184  Dmo-Mir-184  Dno-Mir-184  Dpu-Mir-184  Ete-Mir-184  Gga-Mir-184  Hme-Mir-184  Hsa-Mir-184  Isc-Mir-184  Lan-Mir-184  Mdo-Mir-184  Mml-Mir-184  Mmu-Mir-184  Oan-Mir-184  Ocu-Mir-184  Pfl-Mir-184  Pmi-Mir-184  Rno-Mir-184  Sha-Mir-184  Sko-Mir-184  Spu-Mir-184  Sto-Mir-184  Tca-Mir-184  Tgu-Mir-184  Xtr-Mir-184 
Node of Origin (locus) L. gigantea
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_131: 549624-549681 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUUUAUGCCAAUUUAAUAUCUUUCACGUUUCCUUGUCACUUGUUCGUCUCGUCUAAUAUAAAGAACUGGACGGAGAACUGAUAAGGGCUUGUGGGUGAGAUUUCAGCUUAAUUUAUCA
Get precursor sequence
Structure
        10          20        30        40        50        
CUUUAUGCCAAUUUAAUA--| U      UU         C  G       C  CUAAU 
                    UC UUCACG  UCCUUGUCA UU UUCGUCU GU     A
                    AG GGGUGU  GGGAAUAGU AA AGGCAGG CA     U
ACUAUUUAAUUCGACUUUAG^ U      UC         C  G       U  AGAAA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-184-P5_5p*

MirBase accessionNone
Sequence
0- CCUUGUCACUUGUUCGUCUCGU -22
Get sequence
Mature sequence

Lgi-Mir-184-P5_3p

MirBase accessionMIMAT0009585
Sequence
36- UGGACGGAGAACUGAUAAGGGC -58
Get sequence