MirGeneDB

MirGeneDB ID

Hme-Mir-932

Family name MIR-932 (all species)
Seed CAAUUCC
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-932
Paralogues
Orthologues Aae-Mir-932  Bge-Mir-932  Dan-Mir-932  Dme-Mir-932  Dmo-Mir-932  Tca-Mir-932 
Node of Origin (locus) Neoptera
Node of Origin (family) Neoptera
Genome context
(Hmel_1)
HE670498: 24471-24528 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAAAAGGCAAAGGAAAGGGCGCCGAGGCCUCAAUUCCGUAGUGCAUUGCAGUGCAUAUUGCCCCCUGCAAGCAGUGCGGAAGUGAGGCUGAGGUCUCCUUAAGCAACGUAUCAACAC
Get precursor sequence
Structure
        10          20        30        40        50         
GAAAAAGGCAAAGGAAA--|  C   GA       A       G   A      UGCAUA 
                   GGG GCC  GGCCUCA UUCCGUA UGC UUGCAG      \
                   CCU UGG  UCGGAGU AAGGCGU ACG AACGUC      U
CACAACUAUGCAACGAAUU^  C   AG       G       G   -      CCCCGU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Mature sequence

Hme-Mir-932_5p

MirBase accessionMIMAT0024995
Sequence
0- UCAAUUCCGUAGUGCAUUGCAGU -23
Get sequence
Star sequence

Hme-Mir-932_3p*

MirBase accessionNone
Sequence
36- UGCAAGCAGUGCGGAAGUGAGG -58
Get sequence