MirGeneDB

MirGeneDB ID

Dan-Mir-932

Family name MIR-932 (all species)
Seed CAAUUCC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-932  Bge-Mir-932  Dme-Mir-932  Dmo-Mir-932  Hme-Mir-932  Tca-Mir-932 
Node of Origin (locus) Neoptera
Node of Origin (family) Neoptera
Genome context
(Dana_caf1)
scaffold_12916: 8482577-8482637 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UCUAAUGCCAUAUAUUUGGUUUCGAGACUUUCAAUUCCGUAGUGCAUUGCAGUGUUUUUAAACUACAACUGCAUGCUCUGCGGACUUGGCAGAUUUGAAGACCAGGAGCAACUUUUAAGAA
Get precursor sequence
Structure
        10         20         30        40        50        60
UCUAAUGCCAUAUAUUU-    -|    A  U    U       U    U     GUUUUU 
                  GGUU UCGAG CU UCAA UCCGUAG GCAU GCAGU      A
                  CCAG AGUUU GA GGUU AGGCGUC CGUA CGUCA      A
AAGAAUUUUCAACGAGGA    A^    A  C    C       U    -     ACAUCA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-932_5p

MirBase accessionNone
Sequence
0- UCAAUUCCGUAGUGCAUUGCAGU -23
Get sequence
Star sequence

Dan-Mir-932_3p*

MirBase accessionNone
Sequence
39- UGCAUGCUCUGCGGACUUGGCA -61
Get sequence