MirGeneDB

MirGeneDB ID

Bge-Mir-932

Family name MIR-932 (all species)
Seed CAAUUCC
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues
Orthologues Aae-Mir-932  Dan-Mir-932  Dme-Mir-932  Dmo-Mir-932  Hme-Mir-932  Tca-Mir-932 
Node of Origin (locus) Neoptera
Node of Origin (family) Neoptera
Genome context
(Bger_2.0)
KZ617914.1: 22888-22946 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AGUGAGAAACCUUCAUGCGGUCCUUCUACUUCAAUUCCGUAGUGCAUUGCAGUGUUUGAUGUAGAUCUGCAAGCAGUGCGGAAGUGAGGUGGAAGAGGCUUGGGGAACACCCUGCAACU
Get precursor sequence
Structure
        10         20         30        40        50         
AGUGAGAAACCUUCAUGC-    -|          A       G   A      UGUUUG 
                   GGUC CUUCUACUUCA UUCCGUA UGC UUGCAG      A
                   UCGG GAAGGUGGAGU AAGGCGU ACG AACGUC      U
UCAACGUCCCACAAGGGGU    A^          G       G   -      UAGAUG 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Mir-932_5p

MirBase accessionNone
Sequence
0- UCAAUUCCGUAGUGCAUUGCAGU -23
Get sequence
Co-mature sequence

Bge-Mir-932_3p

MirBase accessionNone
Sequence
37- UGCAAGCAGUGCGGAAGUGAGG -59
Get sequence