MirGeneDB

MirGeneDB ID

Aae-Mir-932

Family name MIR-932 (all species)
Seed CAAUUCC
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-932
Paralogues
Orthologues Bge-Mir-932  Dan-Mir-932  Dme-Mir-932  Dmo-Mir-932  Hme-Mir-932  Tca-Mir-932 
Node of Origin (locus) Neoptera
Node of Origin (family) Neoptera
Genome context
(Aaeg_L3)
supercont1.1064: 154116-154175 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAUAGCCGUUUCUGUAAUCAUAGAAUAGCUUCAAUUCCGUAGUGCAUUGCAGUGUGCUUUAGACGAACUGCAAGCAAUGUGGAAGUGAAGCGAUUCUCAAUGAUCAUCAACAAUCUCAAG
Get precursor sequence
Structure
        10        20          30        40        50          
GAUAGCCGUUUCUGUAAU   --|    A      A       G   A       GUGCUU 
                  CAU  AGAAU GCUUCA UUCCGUA UGC UUGCAGU      \
                  GUA  UCUUA CGAAGU AAGGUGU ACG AACGUCA      U
GAACUCUAACAACUACUA   AC^    G      G       A   -       AGCAGA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Fe Fe Fe Fe To To To
Mature sequence

Aae-Mir-932_5p

MirBase accessionMIMAT0014269
Sequence
0- UCAAUUCCGUAGUGCAUUGCAGU -23
Get sequence
Star sequence

Aae-Mir-932_3p*

MirBase accessionMIMAT0014270
Sequence
38- UGCAAGCAAUGUGGAAGUGAAG -60
Get sequence