MirGeneDB

MirGeneDB ID

Dme-Mir-932

Family name MIR-932 (all species)
Seed CAAUUCC
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-932
Paralogues
Orthologues Aae-Mir-932  Bge-Mir-932  Dan-Mir-932  Dmo-Mir-932  Hme-Mir-932  Tca-Mir-932 
Node of Origin (locus) Neoptera
Node of Origin (family) Neoptera
Genome context
(dm6)
chr2L: 6902077-6902137 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUUUCAAAAAGAGUAUUGGUUUUGAAGUUUUCAAUUCCGUAGUGCAUUGCAGUGUGUUUCAUUAUUUACUGCAAGCGCUGCGGAUUUGGCAACUUUGACGACCUUCAUCAUCUGCUAGAGA
Get precursor sequence
Structure
        10         20         30        40        50        60
AUUUCAAAAAGAGUAUU-    -|UG     U    U          A       GUGUUU 
                  GGUU U  AAGUU UCAA UCCGUAGUGC UUGCAGU      C
                  CCAG A  UUCAA GGUU AGGCGUCGCG AACGUCA      A
AGAGAUCGUCUACUACUU    C^GU     C    U          -       UUUAUU 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-932_5p

MirBase accessionMIMAT0005479
Sequence
0- UCAAUUCCGUAGUGCAUUGCAGU -23
Get sequence
Validated targets microrna.org: MIMAT0005479
TargetScanFly: dme-miR-932
Star sequence

Dme-Mir-932_3p*

MirBase accessionMIMAT0020860
Sequence
39- UGCAAGCGCUGCGGAUUUGGCA -61
Get sequence