MirGeneDB ID | Ete-Mir-598 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-598 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Cja-Mir-598 Cpo-Mir-598 Hsa-Mir-598 Laf-Mir-598 Mml-Mir-598 Mmr-Mir-598 Mmu-Mir-598 Pab-Mir-598 Rno-Mir-598-P1 Rno-Mir-598-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (echTel2) |
JH980320: 20285247-20285304 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | ACGUCAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
GAAGAUGGUUUGAUGAUACUGCUGAUGCUGGUGGUGAUGCCGAUGGUGUGAGCUGGAAAUGGGUGCUACGUCAUCGUUGUCAUCGUCGUCAUCAUCAUCCGAGCAGCCACCGUGUAGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 GAAGAUGGUUUGAUGAUAC--| C C GU GC GU G UGGAA UG UGAUG UG GGUGAU CGAUG GU AGC \ AC ACUAC GC CUACUG GCUAC CA UCG A CGAUGUGCCACCGACGAGCCU^ U U UG UU UG - UGGGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | There are two nt differences between the genomic read and the actual 3p read from the small RNA library (UACGUCAUCGUUGUCAUUGUCA). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Ete-Mir-598_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- GUGGUGAUGCCGAUGGUGUGAGC -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Ete-Mir-598_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
36- UACGUCAUCGUUGUCAUCGUCG -58
Get sequence
|