MirGeneDB ID | Efe-Mir-2-o23 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Common brandling worm (Eisenia fetida) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Efe-Mir-2-o20 Efe-Mir-2-o21 Efe-Mir-2-o22 Efe-Mir-2-o24 Efe-Mir-2-P12f Efe-Mir-2-P12g | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | E. fetida | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (Efe_combined) |
Efet.01.159362: 1072-1126 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-2-o23) |
Mir-2-o24
Efet.01.159362: 648-708 [-]
Mir-2-o23 Efet.01.159362: 1072-1126 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
NNACCAUGUUAUGGGGAGCAGCUGAAGGCCUGGUCAAAGAUUCUGUGAAAUGCUACUGAAUCAUAUCACAGCCGCUUUGACUGGUUCUUAACUGCAUCACAUCUUCACUUUCUGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 NNACCAUGUUAUGGGGA---| C AG U AUU A CUAC GCAG UGA GCC GGUCAAAG CUGUGA AUG \ CGUC AUU UGG UCAGUUUC GACACU UAC U CGUCUUUCACUUCUACACUA^ A CU - GCC A UAAG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Efe-Mir-2-o23_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- UGGUCAAAGAUUCUGUGAAAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Efe-Mir-2-o23_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
33- UAUCACAGCCGCUUUGACUGGU -55
Get sequence
|