MirGeneDB

MirGeneDB ID

Dan-Mir-1000

Family name MIR-1000 (all species)
Seed UAUUGUC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-1000-P1  Aae-Mir-1000-P2  Bge-Mir-1000  Dme-Mir-1000  Dmo-Mir-1000  Hme-Mir-1000  Tca-Mir-1000 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(Dana_caf1)
scaffold_13340: 3670443-3670511 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UAUAUGGUGUCAUAUAGACGCUUGCCGAUGAUAUUGUCCUGUCACAGCAGUAUUGUAAUUCUAUACUAUAUAGCUUACUGCUGGGUCGGGGCAUUAACAUUGUUGAGCGUCAUUAGCAACGAGGAGGAA
Get precursor sequence
Structure
        10          20        30        40        50        60    
UAUAUGGUGUCAUAUAG--|     GC     A  U       UCA        UUGUAAUUCUA 
                   ACGCUU  CGAUG UA UGUCCUG   CAGCAGUA           \
                   UGCGAG  GUUAC AU ACGGGGC   GUCGUCAU           U
AAGGAGGAGCAACGAUUAC^     UU     A  U       UGG        UCGAUAUAUCA 
       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-1000_5p

MirBase accessionNone
Sequence
0- AUAUUGUCCUGUCACAGCAGUA -22
Get sequence
Star sequence

Dan-Mir-1000_3p*

MirBase accessionNone
Sequence
47- CUGCUGGGUCGGGGCAUUAACA -69
Get sequence