| MirGeneDB ID | Cte-Mir-2-o15 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Polychaete worm (Capitella teleta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cte-mir-2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cte-Mir-2-o13 Cte-Mir-2-o14 Cte-Mir-2-o16 Cte-Mir-2-o17 Cte-Mir-2-o18 Cte-Mir-2-o19 Cte-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. teleta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Capitella_teleta_v1.0) |
CAPTEscaffold_933: 10541-10616 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o15) |
Mir-71
CAPTEscaffold_933: 9934-9996 [+]
Ensembl
Mir-2-o13 CAPTEscaffold_933: 10046-10112 [+] Ensembl Mir-2-P12 CAPTEscaffold_933: 10173-10226 [+] Ensembl Mir-2-o14 CAPTEscaffold_933: 10412-10472 [+] Ensembl Mir-2-o15 CAPTEscaffold_933: 10541-10616 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
ACUCUUGUUCUCUGAUCAAUCAUGGAGGAACCGACAAAGUGGCUGCGAUGUGUUCUCUUCCUCCUCCGAUAUGCGUCGCACCAUAUCACAGCCCGCUUUGUUGACUCUGCCGUGCAAUACUCUCCUCUAAUUGGCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 ACUCUUGUUCUCUGAUCAAU-- A AC -| C UUCUCUUCCUCCUC CAUGG GGA CGACAAAGU GGCUG GAUGUG \ GUGCC UCU GUUGUUUCG CCGAC CUAUAC C UCGGUUAAUCUCCUCUCAUAAC G CA C^ A CACGCUGCGUAUAG 130 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cte-Mir-2-o15_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CCGACAAAGUGGCUGCGAUGUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cte-Mir-2-o15_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009503 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
53- UAUCACAGCCCGCUUUGUUGACU -76
Get sequence
|
