MirGeneDB ID | Cte-Mir-2-o14 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Polychaete worm (Capitella teleta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | cte-mir-2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Cte-Mir-2-o13 Cte-Mir-2-o15 Cte-Mir-2-o16 Cte-Mir-2-o17 Cte-Mir-2-o18 Cte-Mir-2-o19 Cte-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | C. teleta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (Capitella_teleta_v1.0) |
CAPTEscaffold_933: 10412-10472 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-2-o14) |
Mir-71
CAPTEscaffold_933: 9934-9996 [+]
Ensembl
Mir-2-o13 CAPTEscaffold_933: 10046-10112 [+] Ensembl Mir-2-P12 CAPTEscaffold_933: 10173-10226 [+] Ensembl Mir-2-o14 CAPTEscaffold_933: 10412-10472 [+] Ensembl Mir-2-o15 CAPTEscaffold_933: 10541-10616 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
UUUUUGUUUGUGUUUUUGGGUUUGAUCGGCCUAUCAAGGUGGCUGGGAUUUGGGUUUUUAUUGCCCCAUAUCACAGCCAGCUUUGAUAAGUUGACUGACCUUCAGUGCGUCAUUCUUUGAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 UUUUUGUUUGUGUUUUU---| UGA C - G U GGUUUU GGGUU UCGGC UAUCAAGG UGGCUG GAU UG U UCCAG AGUUG AUAGUUUC ACCGAC CUA AC A GAGUUUCUUACUGCGUGACU^ UC- A G A U CCCGUU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Cte-Mir-2-o14_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- CUAUCAAGGUGGCUGGGAUUUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Cte-Mir-2-o14_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0009505 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
38- UAUCACAGCCAGCUUUGAUAAGU -61
Get sequence
|