MirGeneDB

MirGeneDB ID

Bta-Mir-190-P1

Family name MIR-190 (all species)
Seed GAUAUGU
Species Cow (Bos taurus)
MiRBase ID bta-mir-190a
Paralogues Bta-Mir-190-P2 
Orthologues Aae-Mir-190  Aca-Mir-190-P1  Ami-Mir-190-P1  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Cbr-Mir-190  Cel-Mir-190  Cfa-Mir-190-P1  Cgi-Mir-190  Cli-Mir-190-P1  Cpi-Mir-190-P1  Cpo-Mir-190-P1  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P1  Dpu-Mir-190  Dre-Mir-190-P1  Ete-Mir-190-P1  Gga-Mir-190-P1  Hme-Mir-190  Hsa-Mir-190-P1  Isc-Mir-190  Mdo-Mir-190-P1  Mml-Mir-190-P1  Mmu-Mir-190-P1  Oan-Mir-190-P1  Ocu-Mir-190-P1  Pfl-Mir-190  Pmi-Mir-190  Rno-Mir-190-P1a  Rno-Mir-190-P1b  Sha-Mir-190-P1  Sko-Mir-190  Sto-Mir-190-P1  Tca-Mir-190  Tgu-Mir-190-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr10: 47321074-47321131 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACCUGGAUGCCUUUCUGCAGGCCUCUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAACUAUAUAUCAAACAUAUUCCUACAGUGUCUUGCCCUGUCUCCGGGGGUUCC
Get precursor sequence
Structure
        10         20        30         40        50         
GACCUGGAUGCCUUUCU-     CCU     U-|               UA     UUAU 
                  GCAGG   CUGUG  GAUAUGUUUGAUAUAU  GGUUG    U
                  CGUUC   GACAU  UUAUACAAACUAUAUA  UCAAC    U
CCUUGGGGGCCUCUGUCC     UGU     CC^               --     CUAA 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-190-P1_5p

MirBase accessionMIMAT0009251
Sequence
0- UGAUAUGUUUGAUAUAUUAGGUUG -24
Get sequence
Validated targets TargetScanVert: bta-miR-190a
Co-mature sequence

Bta-Mir-190-P1_3p

MirBase accessionNone
Sequence
36- ACUAUAUAUCAAACAUAUUCCU -58
Get sequence