MirGeneDB

MirGeneDB ID

Aca-Mir-726

Family name MIR-726 (all species)
Seed UCACUAC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-726
Paralogues
Orthologues Cpi-Mir-726  Dre-Mir-726  Xtr-Mir-726 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(anoCar2)
2: 88642252-88642312 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCCCUCCCAGCUUUCUGGGCGCUCGUCAGGAAUUCCGCUAGUUCUGAACUAUUUACAGUUAGAAAAAGUUCACUACUAGCAGAACUCGGCCGCGCGCUCUUCACUCUUCGGGGGUCAAG
Get precursor sequence
Structure
        10          20         30        40        50        60
CCCCCCUCCCAGCUUUCU--      U -|  AG  A   C      UC      AUUUACA 
                    GGGCGC C GUC  GA UUC GCUAGU  UGAACU       G
                    CUCGCG G CGG  CU AAG CGAUCA  ACUUGA       U
GAACUGGGGGCUUCUCACUU      C C^  --  C   A      UC      AAAAGAU 
 .       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-726_5p*

MirBase accessionNone
Sequence
0- GGAAUUCCGCUAGUUCUGAACU -22
Get sequence
Mature sequence

Aca-Mir-726_3p

MirBase accessionMIMAT0021986
Sequence
40- UUCACUACUAGCAGAACUCGG -61
Get sequence