MirGeneDB

MirGeneDB ID

Aca-Mir-142-P4-v3

Family name MIR-142 (all species)
Seed GUAGUGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-142
Paralogues Aca-Mir-142-P4-v1  Aca-Mir-142-P4-v2  Aca-Mir-142-P4-v4 
Orthologues Ami-Mir-142-P4-v1  Ami-Mir-142-P4-v2  Ami-Mir-142-P4-v3  Ami-Mir-142-P4-v4  Cpi-Mir-142-P4-v1  Cpi-Mir-142-P4-v2  Cpi-Mir-142-P4-v3  Cpi-Mir-142-P4-v4 
Node of Origin (locus) Diapsida
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343287.1: 1405171-1405231 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-142-P4-v3)
Mir-142-P4-v4 GL343287.1: 1405169-1405233 [-] UCSC Ensembl
Mir-142-P4-v1 GL343287.1: 1405171-1405231 [-] UCSC Ensembl
Mir-142-P4-v2 GL343287.1: 1405171-1405231 [-] UCSC Ensembl
Mir-142-P4-v3 GL343287.1: 1405171-1405231 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCUGUAUUUUUAAGGACAGUGGACUCAUCCAUAAAGUAGAAAGCACUACUAAACGCCUGUGCCCAAGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGAGCAACGGAGGCAACAC
Get precursor sequence
Structure
        10          20        30        40        50          
AGCUGUAUUUUUAAGGA--|    G                 A         UAAACGCCU 
                   CAGUG ACUCAUCCAUAAAGUAG AAGCACUAC         \
                   GUCAU UGAGUAGGUAUUUCAUC UUUGUGAUG         G
CACAACGGAGGCAACGAGU^    G                 C         UGAACCCGU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-142-P4-v3_5p*

MirBase accessionMIMAT0021767
Sequence
0- CAUAAAGUAGAAAGCACUACUAA -23
Get sequence
Mature sequence

Aca-Mir-142-P4-v3_3p

MirBase accessionMIMAT0021768
Sequence
38- UGUAGUGUUUCCUACUUUAUGGA -61
Get sequence