MirGeneDB

MirGeneDB ID

Aca-Mir-142-P4-v4

Family name MIR-142 (all species)
Seed CCAUAAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-142
Paralogues Aca-Mir-142-P4-v1  Aca-Mir-142-P4-v2  Aca-Mir-142-P4-v3 
Orthologues Ami-Mir-142-P4-v1  Ami-Mir-142-P4-v2  Ami-Mir-142-P4-v3  Ami-Mir-142-P4-v4  Cpi-Mir-142-P4-v1  Cpi-Mir-142-P4-v2  Cpi-Mir-142-P4-v3  Cpi-Mir-142-P4-v4 
Node of Origin (locus) Diapsida
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343287.1: 1405169-1405233 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-142-P4-v4)
Mir-142-P4-v4 GL343287.1: 1405169-1405233 [-] UCSC Ensembl
Mir-142-P4-v1 GL343287.1: 1405171-1405231 [-] UCSC Ensembl
Mir-142-P4-v2 GL343287.1: 1405171-1405231 [-] UCSC Ensembl
Mir-142-P4-v3 GL343287.1: 1405171-1405231 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGCUGUAUUUUUAAGGACAGUGGACUCAUCCAUAAAGUAGAAAGCACUACUAAACGCCUGUGCCCAAGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGAGCAACGGAGGCAACACAA
Get precursor sequence
Structure
        10          20        30        40        50        60  
GAAGCUGUAUUUUUAAGG--|     G                 A         UAAACGCCU 
                    ACAGUG ACUCAUCCAUAAAGUAG AAGCACUAC         \
                    UGUCAU UGAGUAGGUAUUUCAUC UUUGUGAUG         G
AACACAACGGAGGCAACGAG^     G                 C         UGAACCCGU 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-142-P4-v4_5p

MirBase accessionMIMAT0021767
Sequence
0- UCCAUAAAGUAGAAAGCACUAC -22
Get sequence
Star sequence

Aca-Mir-142-P4-v4_3p*

MirBase accessionMIMAT0021768
Sequence
43- AGUGUUUCCUACUUUAUGGAUG -65
Get sequence