MirGeneDB

MirGeneDB ID

Aca-Mir-1397

Family name MIR-1397 (all species)
Seed GCAUUGC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-1397
Paralogues
Orthologues Ami-Mir-1397  Cpi-Mir-1397  Gga-Mir-1397  Oan-Mir-1397  Sha-Mir-1397  Tgu-Mir-1397 
Node of Origin (locus) Amniota
Node of Origin (family) Amniota
Genome context
(anoCar2)
3: 116429089-116429146 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAACUCACUGACAAACUGUGAUGUGUGCAUUGCAUUGCGAUGGGUUACAUCACUGGUCAUAGCAUGAUGUAACCCAACGCAGCAUGGUGUAAGCAUCGUAAUACAUUGGAGAUUUAAA
Get precursor sequence
Structure
        10          20        30        40        50        
UAACUCACUGACAAACUG--|     G       CA     A            CUGGU 
                    UGAUGU UGCAUUG  UUGCG UGGGUUACAUCA     C
                    GCUACG AUGUGGU  GACGC ACCCAAUGUAGU     A
AAAUUUAGAGGUUACAUAAU^     A       AC     A            ACGAU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-1397_5p

MirBase accessionMIMAT0021764
Sequence
0- UGCAUUGCGAUGGGUUACAUCA -22
Get sequence
Star sequence

Aca-Mir-1397_3p*

MirBase accessionNone
Sequence
36- AUGUAACCCAACGCAGCAUGGU -58
Get sequence