MirGeneDB

Gene name

Dre-Mir-15-P2d

Family name MIR-15 (all species)
MiRBase ID dre-mir-457b
Paralogues Dre-Mir-15-P1a1  Dre-Mir-15-P1a2  Dre-Mir-15-P1b  Dre-Mir-15-P1c  Dre-Mir-15-P2a1  Dre-Mir-15-P2a2  Dre-Mir-15-P2b  Dre-Mir-15-P2c 
Orthologues Aca-Mir-15-P2d  Ami-Mir-15-P2d  Bta-Mir-15-P2d  Cfa-Mir-15-P2d  Cin-Mir-15-o2  Cli-Mir-15-P2d  Cpo-Mir-15-P2d  Dno-Mir-15-P2d  Ete-Mir-15-P2d  Gga-Mir-15-P2d  Hsa-Mir-15-P2d  Mdo-Mir-15-P2d-v1  Mdo-Mir-15-P2d-v2  Mml-Mir-15-P2d  Mmu-Mir-15-P2d  Ocu-Mir-15-P2d  Rno-Mir-15-P2d1  Rno-Mir-15-P2d2  Sha-Mir-15-P2d-v1  Sha-Mir-15-P2d-v2  Tgu-Mir-15-P2d  Xtr-Mir-15-P2d 
Node of Origin (gene) Vertebrata
Node of Origin (family) Olfactores
Genome context
(danRer11_plustraces)
chr14: 31521938-31521997 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGAGCAGCAGAUCUGAAGGGAAUGUACUAAAGCAGCACAUAAAUACUGGAGGUGAUUGUGGUGUUAUCCAGUAUUGCUGUUCUGCUGUAGUAAGACCUGUCAGCACUUACAGACUCCAA
Get precursor sequence
Structure
        10            20        30        40        50         
GAGAGCAGCAGAUCUGA----|  GAAUG     A     C   UA         GGUGAUU 
                     AGG     UACUA AGCAG ACA  AAUACUGGA       G
                     UCC     AUGAU UCGUC UGU  UUAUGACCU       U
AACCUCAGACAUUCACGACUG^  AGA--     G     U   CG         AUUGUGG 
.       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-15-P2d_5p

MirBase accessionMIMAT0001884
Sequence
0- AAGCAGCACAUAAAUACUGGAGG -23
Get sequence
Seed sequenceAGCAGCA
Validated targets TargetScanFish: dre-miR-457b
Star sequence

Dre-Mir-15-P2d_3p*

MirBase accessionMIMAT0032004
Sequence
37- UCCAGUAUUGCUGUUCUGCUGUA -60
Get sequence