MirGeneDB

MirGeneDB ID

Dre-Mir-15-P1a2

Family name MIR-15 (all species)
Seed AGCAGCA
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-15a-2
Paralogues Dre-Mir-15-P1a1  Dre-Mir-15-P1b  Dre-Mir-15-P1c  Dre-Mir-15-P2a1  Dre-Mir-15-P2a2  Dre-Mir-15-P2b  Dre-Mir-15-P2c  Dre-Mir-15-P2d 
Orthologues Ami-Mir-15-P1a  Bta-Mir-15-P1a  Cfa-Mir-15-P1a  Cin-Mir-15-P1  Cli-Mir-15-P1a  Cpi-Mir-15-P1a  Cpo-Mir-15-P1a  Dno-Mir-15-P1a  Ete-Mir-15-P1a  Gga-Mir-15-P1a  Hsa-Mir-15-P1a  Mdo-Mir-15-P1a  Mml-Mir-15-P1a  Mmu-Mir-15-P1a  Oan-Mir-15-P1a  Ocu-Mir-15-P1a  Rno-Mir-15-P1a  Sha-Mir-15-P1a  Sto-Mir-15-P1a  Tgu-Mir-15-P1a  Xtr-Mir-15-P1a 
Node of Origin (locus) D. rerio
Node of Origin (family) Olfactores
Genome context
(danRer11)
chr9: 29652531-29652588 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P1a2)
Mir-15-P2a2 chr9: 29652389-29652453 [-] UCSC Ensembl
Mir-15-P1a2 chr9: 29652531-29652588 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAUGUAGCCGAGGCUCUCUAGGUGAUGGUGUAGCAGCACAGAAUGGUUUGUGGUGAUACAGAGAUGCAGGCCAUGAUGUGCUGCAGCAUCAAUUCCUGGGACCUACGCAGUUGAGAGA
Get precursor sequence
Structure
        10          20        30        40        50        
CAUGUAGCCGAGGCUCU--|    UGA      A        GA          GUGAU 
                   CUAGG   UGGUGU GCAGCACA  AUGGUUUGUG     A
                   GGUCC   ACUACG CGUCGUGU  UACCGGACGU     C
AGAGAGUUGACGCAUCCAG^    UUA      A        AG          AGAGA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-15-P1a2_5p

MirBase accessionMIMAT0001772
Sequence
0- UAGCAGCACAGAAUGGUUUGUG -22
Get sequence
Validated targets TargetScanFish: dre-miR-15a
Star sequence

Dre-Mir-15-P1a2_3p*

MirBase accessionNone
Sequence
36- CAGGCCAUGAUGUGCUGCAGCA -58
Get sequence