MirGeneDB

Gene name

Dre-Mir-15-P2a2

Family name MIR-15 (all species)
MiRBase ID dre-mir-16c
Paralogues Dre-Mir-15-P1a1  Dre-Mir-15-P1a2  Dre-Mir-15-P1b  Dre-Mir-15-P1c  Dre-Mir-15-P2a1  Dre-Mir-15-P2b  Dre-Mir-15-P2c  Dre-Mir-15-P2d 
Orthologues Ami-Mir-15-P2a  Bta-Mir-15-P2a  Cfa-Mir-15-P2a  Cin-Mir-15-o2  Cli-Mir-15-P2a  Cpi-Mir-15-P2a  Cpo-Mir-15-P2a  Dno-Mir-15-P2a  Ete-Mir-15-P2a  Gga-Mir-15-P2a  Hsa-Mir-15-P2a  Mdo-Mir-15-P2a  Mml-Mir-15-P2a  Mmu-Mir-15-P2a  Ocu-Mir-15-P2a  Rno-Mir-15-P2a  Sha-Mir-15-P2a  Tgu-Mir-15-P2a  Xtr-Mir-15-P2a 
Node of Origin (gene) Teleostei
Node of Origin (family) Olfactores
Genome context
(danRer11_plustraces)
chr9: 29652389-29652453 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P2a2)
Mir-15-P1a2 chr9: 29652531-29652588 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUGUGUGUGUGCGUGUGUUGUCUUGCUUUAGCAGCAUGUAAAUAUUGGAGUUACUCCUUGGCCAAUGCCUCCAAUAUUGCUCGUGCUGCUGAAGCAAGAAGUCACCAAGCAGCACAUGCACGU
Get precursor sequence
Structure
        10          20        30        40         50        60 
UUGUGUGUGUGUGCGUG--  UUG                  UA-|         UUACUCCU 
                   UG   UCUUGCUUUAGCAGCAUG   AAUAUUGGAG        U
                   AC   AGAACGAAGUCGUCGUGC   UUAUAACCUC        G
UGCACGUACACGACGAACC  UGA                  UCG^         CGUAACCG 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-15-P2a2_5p

MirBase accessionMIMAT0001776
Sequence
0- UAGCAGCAUGUAAAUAUUGGAGU -23
Get sequence
Seed sequenceAGCAGCA
Validated targets TargetScanFish: dre-miR-16c
Star sequence

Dre-Mir-15-P2a2_3p*

MirBase accessionMIMAT0031937
Sequence
41- UCCAAUAUUGCUCGUGCUGCUGAA -65
Get sequence