MirGeneDB

Gene name

Dno-Mir-653

Family name MIR-653 (all species)
MiRBase ID dno-mir-653
Paralogues
Orthologues Bta-Mir-653  Cfa-Mir-653  Cpo-Mir-653  Hsa-Mir-653  Mml-Mir-653  Mmu-Mir-653  Ocu-Mir-653  Rno-Mir-653 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(dasNov3)
JH574710: 688203-688265 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-653)
Mir-489 JH574710: 687595-687653 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AACAGAAGCUCCAAUUUCUCAUUUCUUCAGUGUUGAAACAAUCUCUGGUGAGCUAAGUCCCAAGUCAUGUUCACUGGAGUUUGUUUCAACACUGUAUGAAUGAUUAAAUUUAUGCAAGUGUCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
AACAGAAGCUCCAAUUUC--|     CUU              U   UG      UAAGUCC 
                    UCAUUU   CAGUGUUGAAACAA CUC  GUGAGC       \
                    AGUAAG   GUCACAACUUUGUU GAG  CACUUG       C
ACUGUGAACGUAUUUAAAUU^     UAU              U   GU      UACUGAA 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThe Drosha site in the armadillo orthologue is -2 relative to human and most other mammals analyzed.
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Dno-Mir-653_5p

MirBase accessionMIMAT0047988
Sequence
0- UGUUGAAACAAUCUCUGGUGAGC -23
Get sequence
Seed sequenceGUUGAAA
Co-mature sequence

Dno-Mir-653_3p

MirBase accessionMIMAT0047989
Sequence
40- UCACUGGAGUUUGUUUCAACACU -63
Get sequence
Seed sequenceCACUGGA