MirGeneDB

Gene name

Rno-Mir-653

Family name MIR-653 (all species)
MiRBase ID rno-mir-653
Paralogues
Orthologues Bta-Mir-653  Cfa-Mir-653  Cpo-Mir-653  Dno-Mir-653  Hsa-Mir-653  Mml-Mir-653  Mmu-Mir-653  Ocu-Mir-653 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr4: 28658901-28658959 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-653)
Mir-489 chr4: 28659547-28659606 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGAGGUUCUGAUUUUUCAUUCUUUCAGUGUUGAAACAUUCUCUACUGAACCAAGCUCCAAAACAAGUUCACUGGGGUUUGUUUCACUAUUGCAAGAAUUGCUAAGUAUGAAGCUGCUC
Get precursor sequence
Structure
        10          20        30        40        50         
CUGAGGUUCUGAUUUUUC--|     U     U       UU     C     CAAGCUC 
                    AUUCUU CAGUG UGAAACA  CUCUA UGAAC       \
                    UAAGAA GUUAU ACUUUGU  GGGGU ACUUG       C
CUCGUCGAAGUAUGAAUCGU^     C     C       UU     C     AACAAAA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-653_5p

MirBase accessionMIMAT0012838
Sequence
0- UUGAAACAUUCUCUACUGAACC -22
Get sequence
Seed sequenceUGAAACA
Validated targets microrna.org: MIMAT0012838
TargetScanVert: rno-miR-653-5p
miRDB: MIMAT0012838
Star sequence

Rno-Mir-653_3p*

MirBase accessionMIMAT0017361
Sequence
37- UUCACUGGGGUUUGUUUCACUA -59
Get sequence
Validated targets TargetScanVert: rno-miR-653-3p
miRDB: MIMAT0017361