MirGeneDB

Gene name

Ocu-Mir-653

Family name MIR-653 (all species)
MiRBase ID ocu-mir-653
Paralogues
Orthologues Bta-Mir-653  Cfa-Mir-653  Cpo-Mir-653  Dno-Mir-653  Hsa-Mir-653  Mml-Mir-653  Mmu-Mir-653  Rno-Mir-653 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(oryCun2)
chr10: 35346249-35346307 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-653)
Mir-489 chr10: 35345574-35345633 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGAGGUUCUGAUUUCCCAUUCUUUCAGUGUUGAAACAUCCUCUAUUGAAUUAGGCUUUCAACCAAGUUCACUGGAGUUUGUUUCAAUAUUGCAAGAAUGAUAAGAUUGAAGCUACUGU
Get precursor sequence
Structure
        10          20        30        40        50         
CAGAGGUUCUGAUUUCC--|      U             UC     U      AGGCUU 
                   CAUUCUU CAGUGUUGAAACA  CUCUA UGAAUU      \
                   GUAAGAA GUUAUAACUUUGU  GAGGU ACUUGA      U
UGUCAUCGAAGUUAGAAUA^      C             UU     C      ACCAAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
He Ki Te To Wh
Mature sequence

Ocu-Mir-653_5p

MirBase accessionMIMAT0048543
Sequence
0- UUGAAACAUCCUCUAUUGAAUU -22
Get sequence
Seed sequenceUGAAACA
Co-mature sequence

Ocu-Mir-653_3p

MirBase accessionMIMAT0048544
Sequence
37- UUCACUGGAGUUUGUUUCAAUA -59
Get sequence
Seed sequenceUCACUGG