MirGeneDB

Gene name

Mmu-Mir-653

Family name MIR-653 (all species)
MiRBase ID mmu-mir-653
Paralogues
Orthologues Bta-Mir-653  Cfa-Mir-653  Cpo-Mir-653  Dno-Mir-653  Hsa-Mir-653  Mml-Mir-653  Ocu-Mir-653  Rno-Mir-653 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr6: 3721314-3721372 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-653)
Mir-489 chr6: 3721922-3721981 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGAGGUUCUGAGAUUUCAUUCUUUCAGUGUUGAAACAAUCUCUACUGAACCAAGCUCCAAAGCGAGUUCACUGGAGUUUGUUUCAGUAUUGCAGGAGUGCUAAGUGUGAAGCUGCCCC
Get precursor sequence
Structure
        10          20        30        40        50         
CAGAGGUUCUGAGAUUU--|      U              U     C     CAAGCUC 
                   CAUUCUU CAGUGUUGAAACAA CUCUA UGAAC       \
                   GUGAGGA GUUAUGACUUUGUU GAGGU ACUUG       C
CCCCGUCGAAGUGUGAAUC^      C              U     C     AGCGAAA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-653_5p

MirBase accessionMIMAT0004943
Sequence
0- UUGAAACAAUCUCUACUGAACC -22
Get sequence
Seed sequenceUGAAACA
Validated targets microrna.org: MIMAT0004943
miRDB: MIMAT0004943
Star sequence

Mmu-Mir-653_3p*

MirBase accessionMIMAT0017284
Sequence
37- UUCACUGGAGUUUGUUUCAGUA -59
Get sequence
Validated targets TargetScanVert: mmu-miR-653-3p
miRDB: MIMAT0017284