MirGeneDB

Gene name

Cpo-Mir-653

Family name MIR-653 (all species)
MiRBase ID cpo-mir-653
Paralogues
Orthologues Bta-Mir-653  Cfa-Mir-653  Dno-Mir-653  Hsa-Mir-653  Mml-Mir-653  Mmu-Mir-653  Ocu-Mir-653  Rno-Mir-653 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(cavPor3)
scaffold_11: 25053804-25053862 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AACAGAGGUUCCUAUUUCCUUCCUUCAGUGUUGAAACACUCUCUACUGAACCAGGCUCCACACCAAGUUCACUGGAGUUUGUUUCAGUAUUGCAAGAAUGAUAAGAUUGAAGCUACUGC
Get precursor sequence
Structure
        10        20          30        40        50         
AACAGAGGUUCCUAUUUCCUUC-   -|            CU     C     CAGGCUC 
                       CUU CAGUGUUGAAACA  CUCUA UGAAC       \
                       GAA GUUAUGACUUUGU  GAGGU ACUUG       C
CGUCAUCGAAGUUAGAAUAGUAA   C^            UU     C     AACCACA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Cpo-Mir-653_5p

MirBase accessionMIMAT0047357
Sequence
0- UUGAAACACUCUCUACUGAACC -22
Get sequence
Seed sequenceUGAAACA
Star sequence

Cpo-Mir-653_3p* (predicted)

MirBase accessionMIMAT0047358
Sequence
37- UUCACUGGAGUUUGUUUCAGUA -59
Get sequence