MirGeneDB

Gene name

Bta-Mir-653

Family name MIR-653 (all species)
MiRBase ID bta-mir-653
Paralogues
Orthologues Cfa-Mir-653  Cpo-Mir-653  Dno-Mir-653  Hsa-Mir-653  Mml-Mir-653  Mmu-Mir-653  Ocu-Mir-653  Rno-Mir-653 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr4: 10653544-10653604 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-653)
Mir-489 chr4: 10654205-10654264 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACAGAAGUUCUAAUAUCUCAUUCCCUCAGUGUUGAAACAAUCUCUGUUGAACCAUGUUACAGGAAGUUCACUGGAGUUUGUUUCAACAUUGGAGGAAUGAUAAGAUGCUACUGUUGUCUA
Get precursor sequence
Structure
        10          20        30        40        50          
GACAGAAGUUCUAAUAUC--|      CU              U    GU    CCAUGUU 
                    UCAUUCC  CAGUGUUGAAACAA CUCU  UGAA       \
                    AGUAAGG  GUUACAACUUUGUU GAGG  ACUU       A
AUCUGUUGUCAUCGUAGAAU^      AG              U    UC    GAAGGAC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Ce Co He Hy Ki La Lo No Te
Mature sequence

Bta-Mir-653_5p

MirBase accessionMIMAT0009358
Sequence
0- UGUUGAAACAAUCUCUGUUGAA -22
Get sequence
Seed sequenceGUUGAAA
Star sequence

Bta-Mir-653_3p*

MirBase accessionNone
Sequence
39- CACUGGAGUUUGUUUCAACAUU -61
Get sequence