MirGeneDB

Gene name

Cfa-Mir-653

Family name MIR-653 (all species)
MiRBase ID cfa-mir-653
Paralogues
Orthologues Bta-Mir-653  Cpo-Mir-653  Dno-Mir-653  Hsa-Mir-653  Mml-Mir-653  Mmu-Mir-653  Ocu-Mir-653  Rno-Mir-653 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(canFam3)
chr14: 18979485-18979543 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-653)
Mir-489 chr14: 18980191-18980250 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGAAGUUCUAAUUUCUCAUUCCUUCAGUGUUGAAACAAUCUCUAUUGAACCAGGCUCCAAACCAAGUUCACUGGAGUUUGUUUCAAUAUUGCAAGAAUGAUAAGAUUGAUCCUACUAU
Get precursor sequence
Structure
        10          20        30        40        50         
CAGAAGUUCUAAUUUCU--|    CUU              U     U     CAGGCUC 
                   CAUUC   CAGUGUUGAAACAA CUCUA UGAAC       \
                   GUAAG   GUUAUAACUUUGUU GAGGU ACUUG       C
UAUCAUCCUAGUUAGAAUA^    AAC              U     C     AACCAAA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Mature sequence

Cfa-Mir-653_5p

MirBase accessionMIMAT0009924
Sequence
0- UUGAAACAAUCUCUAUUGAACC -22
Get sequence
Seed sequenceUGAAACA
Validated targets miRDB: MIMAT0009924
Co-mature sequence

Cfa-Mir-653_3p

MirBase accessionNone
Sequence
37- UUCACUGGAGUUUGUUUCAAUA -59
Get sequence
Seed sequenceUCACUGG