MirGeneDB

Gene name

Hsa-Mir-653

Family name MIR-653 (all species)
MiRBase ID hsa-mir-653
Paralogues
Orthologues Bta-Mir-653  Cfa-Mir-653  Cpo-Mir-653  Dno-Mir-653  Mml-Mir-653  Mmu-Mir-653  Ocu-Mir-653  Rno-Mir-653 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(hg38)
chr7: 93482784-93482840 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-653)
Mir-489 chr7: 93483947-93484006 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGAGGUUCUAAUUUUUCAUUCCUUCAGUGUUGAAACAAUCUCUACUGAACCAGCUUCAAACAAGUUCACUGGAGUUUGUUUCAAUAUUGCAAGAAUGAUAAGAUGGAAGCUACUUU
Get precursor sequence
Structure
        10          20        30        40        50        
CAGAGGUUCUAAUUUUU--|    CUU              U     C     CAGCUU 
                   CAUUC   CAGUGUUGAAACAA CUCUA UGAAC      \
                   GUAAG   GUUAUAACUUUGUU GAGGU ACUUG      C
UUUCAUCGAAGGUAGAAUA^    AAC              U     C     AACAAA 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Bo Bo Bo Br Br Ce Co He Ki Li Li Lu Pa Pl Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-653_5p

MirBase accessionMIMAT0003328
Sequence
0- UUGAAACAAUCUCUACUGAACC -22
Get sequence
Seed sequenceUGAAACA
Validated targets microrna.org: MIMAT0003328
miRDB: MIMAT0003328
Annotation deviationYes (sequence)
Star sequence

Hsa-Mir-653_3p*

MirBase accessionMIMAT0026625
Sequence
35- UUCACUGGAGUUUGUUUCAAUA -57
Get sequence
Validated targets TargetScanVert: hsa-miR-653-3p
miRDB: MIMAT0026625
Annotation deviationYes (coordinates)