MirGeneDB

MirGeneDB ID

Tca-Mir-11626

Family name MIR-11626 (all species)
Seed GGCAUGA
Species Red flour beetle (Tribolium castaneum)
MiRBase ID tca-mir-11626a
Paralogues
Orthologues
Node of Origin (locus) T. castaneum
Node of Origin (family) T. castaneum
Genome context
(Tcas5.2)
LG6: 273389-273446 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-11626)
Mir-3851-P2 LG6: 272921-272978 [-] Ensembl
Mir-3851-P3 LG6: 273025-273083 [-] Ensembl
Mir-11626 LG6: 273389-273446 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAUUUUCGUCAAGAUUUUGGUUUUGUUUGUUGGCAUGAUUGAUUUAGCUCAUGUUGAAUUGGUUCAUGAGUUGAUCAAGUAGGCCGAGAAACGGAGCCACCUCCGAAUUUUGUGUUUU
Get precursor sequence
Structure
        10          20        30        40        50         
GAUUUUCGUCAAGAUUU--|          G     AUGA      U        UUGAA 
                   UGGUUUUGUUU UUGGC    UUGAUU AGCUCAUG     \
                   ACCGAGGCAAA AGCCG    AACUAG UUGAGUAC     U
UUUUGUGUUUUAAGCCUCC^          G     GAUG      -        UUGGU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ea Em Em Em Em Em Fe Fe Fe Fe Oo
Mature sequence

Tca-Mir-11626_5p

MirBase accessionMIMAT0045540
Sequence
0- UGGCAUGAUUGAUUUAGCUCAUG -23
Get sequence
Co-mature sequence

Tca-Mir-11626_3p

MirBase accessionMIMAT0045541
Sequence
36- UGAGUUGAUCAAGUAGGCCGAG -58
Get sequence