MirGeneDB

MirGeneDB ID

Sko-Mir-9-v2

Family name MIR-9 (all species)
Seed CUUUGGU
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-9
Paralogues Sko-Mir-9-v1 
Orthologues Cin-Mir-9  Cte-Mir-9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pfl-Mir-9-v2  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Skow_1.1)
NW_003125887.1: 164505-164564 [-]
Clustered MiRNAs
(< 10kb from Mir-9-v2)
Mir-9-v1 NW_003125887.1: 164505-164564 [-]
Mir-9-v2 NW_003125887.1: 164505-164564 [-]
Precursor
(pre-Mir +30nt flank)
UUGAAUUCCGAAUUUUUGGCUCUCGUUUUCUCUUUGGUUAUCUAGCUGUAUGAGUGUACAUGACAUUAUAAAGCUAGGUUACCAAAGACAAAAACAGAUGCCAGUGAUCACCGAUGCCGG
Get precursor sequence
Structure
        10         20         30         40        50         
UUGAAUUCCGAAUUUUU-   -|  C     C-        U        G    AGUGUA 
                  GGC UCU GUUUU  UCUUUGGU AUCUAGCU UAUG      C
                  CCG AGA CAAAA  AGAAACCA UGGAUCGA AUAU      A
GGCCGUAGCCACUAGUGA   U^  -     AC        U        A    UACAGU 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Mature sequence

Sko-Mir-9-v2_5p

MirBase accessionMIMAT0009610
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Co-mature sequence

Sko-Mir-9-v2_3p

MirBase accessionMIMAT0009618
Sequence
38- UAAAGCUAGGUUACCAAAGACA -60
Get sequence