MirGeneDB

MirGeneDB ID

Ocu-Mir-208-P2

Family name MIR-208 (all species)
Seed UAAGACG
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-208b
Paralogues Ocu-Mir-208-P1 
Orthologues Bta-Mir-208-P2  Cfa-Mir-208-P2  Cpo-Mir-208-P2  Dno-Mir-208-P2  Dre-Mir-208-P2  Ete-Mir-208-P2a  Ete-Mir-208-P2b  Hsa-Mir-208-P2  Mdo-Mir-208-P2  Mml-Mir-208-P2  Mmu-Mir-208-P2  Rno-Mir-208-P2  Sha-Mir-208-P2  Sto-Mir-208-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(oryCun2)
chr17: 43610547-43610603 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCUGGCCCCACUUCCUUCUCCUCUCAGGGAAGCUUUUUGCUCGCAUUAUGUUUCUCAUCCGAAUAUAAGACGAACAAAAGGUUUGUCUGAGAGCAGAGAGCUCCCACCUGGGGCAG
Get precursor sequence
Structure
        10          20        30        40        50        
CCCUGGCCCCACUUCCU--|  C        G          C   CA      UUCUC 
                   UCU CUCUCAGG AAGCUUUUUG UCG  UUAUGU     \
                   AGA GAGAGUCU UUUGGAAAAC AGC  AAUAUA     A
GACGGGGUCCACCCUCGAG^  C        G          A   AG      AGCCU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-208-P2_5p* (predicted)

MirBase accessionMIMAT0048331
Sequence
0- AAGCUUUUUGCUCGCAUUAUGU -22
Get sequence
Mature sequence

Ocu-Mir-208-P2_3p

MirBase accessionMIMAT0048332
Sequence
35- AUAAGACGAACAAAAGGUUUGU -57
Get sequence