MirGeneDB

MirGeneDB ID

Mmu-Mir-203-v2

Family name MIR-203 (all species)
Seed GAAAUGU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-203
Paralogues Mmu-Mir-203-v1 
Orthologues Aca-Mir-203-v2  Ami-Mir-203-v2  Bta-Mir-203-v2  Cfa-Mir-203-v2  Cpi-Mir-203-v2  Cpo-Mir-203-v2  Dno-Mir-203-v2  Ete-Mir-203-v2  Gga-Mir-203-v2  Hsa-Mir-203-v2  Mdo-Mir-203-v2  Mml-Mir-203-v2  Oan-Mir-203-v2  Rno-Mir-203-v2  Sha-Mir-203-v2  Sto-Mir-203-v2  Tgu-Mir-203-v2  Xtr-Mir-203-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr12: 112130889-112130948 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-203-v2)
Mir-203-v1 chr12: 112130889-112130948 [+] UCSC Ensembl
Mir-203-v2 chr12: 112130889-112130948 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAACUUCUGUGUGCAGGCGCGCCUGGUCCAGUGGUUCUUGACAGUUCAACAGUUCUGUAGCACAAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGCGCACGGCGGCGACGACAGCAG
Get precursor sequence
Structure
        10          20        30        40        50          
AGAACUUCUGUGUGCAG--|      U    C         U    G    A  GUUCUGU 
                   GCGCGCC GGUC AGUGGUUCU GACA UUCA CA       \
                   CGCGCGG CCAG UCACCAGGA UUGU AAGU GU       A
GACGACAGCAGCGGCGGCA^      C    A         U    A    -  UAACACG 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-203-v2_5p*

MirBase accessionMIMAT0004547
Sequence
0- AGUGGUUCUUGACAGUUCAACA -22
Get sequence
Validated targets microrna.org: MIMAT0004547
TargetScanVert: mmu-miR-203-5p
miRDB: MIMAT0004547
Mature sequence

Mmu-Mir-203-v2_3p

MirBase accessionMIMAT0000236
Sequence
39- UGAAAUGUUUAGGACCACUAG -60
Get sequence
Validated targets microrna.org: MIMAT0000236
TargetScanVert: mmu-miR-203-3p.1
miRDB: MIMAT0000236