MirGeneDB

MirGeneDB ID

Lgi-Mir-1984

Family name MIR-1984 (all species)
Seed GCCCUAU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1984
Paralogues
Orthologues Cgi-Mir-1984 
Node of Origin (locus) Mollusca
Node of Origin (family) Mollusca
Genome context
(Lotgi1)
LOTGIsca_4: 4879135-4879195 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-1984)
Mir-1984 LOTGIsca_4: 4879135-4879195 [+] Ensembl
Mir-1985 LOTGIsca_4: 4881330-4881387 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGGUAAUUGAAACUUAUGCCUACGAUGCCUUGCCCUAUCCGUCAGGAACUGUGAUAUAGUUAAUAGACACAGUGCCUAUCGGUAGGGAACAGUAUCGCAGAGCUCGUCAGCUGAGUCAGGA
Get precursor sequence
Structure
        10          20        30        40        50        60
UGGUAAUUGAAACUUAU-  -| A      CUUG     U   UC   A      AUAUAG 
                  GC CU CGAUGC    CCCUA CCG  AGG ACUGUG      U
                  CG GA GCUAUG    GGGAU GGC  UCC UGACAC      U
AGGACUGAGUCGACUGCU  A^ C      ACAA     -   UA   G      AGAUAA 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-1984_5p

MirBase accessionMIMAT0009726
Sequence
0- UGCCCUAUCCGUCAGGAACUGUG -23
Get sequence
Star sequence

Lgi-Mir-1984_3p* (predicted)

MirBase accessionNone
Sequence
39- CAGUGCCUAUCGGUAGGGAACA -61
Get sequence