MirGeneDB

MirGeneDB ID

Lgi-Mir-1985

Family name MIR-1985 (all species)
Seed GCCAUUU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1985
Paralogues
Orthologues Cgi-Mir-1985 
Node of Origin (locus) Mollusca
Node of Origin (family) Mollusca
Genome context
(Lotgi1)
LOTGIsca_4: 4881330-4881387 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-1985)
Mir-1984 LOTGIsca_4: 4879135-4879195 [+] Ensembl
Mir-1985 LOTGIsca_4: 4881330-4881387 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAAUAGAAGAUUUUUAAGUGGUGUUGCCAUGCCAUUUUUAUCAGUCACUGUGAUUCAUUAUUCUACAGUGCCUGUUAGAAUGGUUUGAUGAGCCGCUAAAUACAACGAAUAUUAAUA
Get precursor sequence
Structure
        10           20        30        40        50         
GAAAUAGAAGAUUUUUA---|     G  GC  U        UAU   U       AUUCA 
                    AGUGGU UU  CA GCCAUUUU   CAG CACUGUG     \
                    UCGCCG AG  GU UGGUAAGA   GUC GUGACAU     U
AUAAUUAUAAGCAACAUAAA^     -  UA  U        UU-   C       CUUAU 
      110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-1985_5p

MirBase accessionMIMAT0009727
Sequence
0- UGCCAUUUUUAUCAGUCACUGUG -23
Get sequence
Star sequence

Lgi-Mir-1985_3p* (predicted)

MirBase accessionNone
Sequence
36- CAGUGCCUGUUAGAAUGGUUUG -58
Get sequence