MirGeneDB

MirGeneDB ID

Lgi-Mir-10-P5

Family name MIR-10 (all species)
Seed UACCCUG
Species Owl limpet (Lottia gigantea)
MiRBase ID
Paralogues Lgi-Mir-10-P1  Lgi-Mir-10-P2  Lgi-Mir-10-P3  Lgi-Mir-10-P6 
Orthologues Cgi-Mir-10-P5  Cte-Mir-10-P5  Efe-Mir-10-P5a  Efe-Mir-10-P5b 
Node of Origin (locus) Lophotrochozoa
Node of Origin (family) Eumetazoa
Genome context
(Lotgi1)
LOTGIsca_12: 2736439-2736501 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAUCUACUCCGAGAAAUGGGCUUGGUUCGUUUACCCUGUAGUACCGAGCAAGUGGACAAUUUUGAAAAACACUGUUCGCUACUGGGGGUCAAAGAACUGAGUUUGAAAACAACAAUUCAGAAG
Get precursor sequence
Structure
        10          20        30        40        50        60  
GAUCUACUCCGAGAAAU--|    UG    G  U     G     C      A   GACAAUU 
                   GGGCU  GUUC UU ACCCU UAGUA CGAGCA GUG       \
                   UUUGA  CAAG AA UGGGG GUCAU GCUUGU CAC       U
GAAGACUUAACAACAAAAG^    GU    A  C     -     C      -   AAAAAGU 
 120       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-10-P5_5p

MirBase accessionNone
Sequence
0- UUACCCUGUAGUACCGAGCAAGUG -24
Get sequence
Star sequence

Lgi-Mir-10-P5_3p* (predicted)

MirBase accessionNone
Sequence
41- CUGUUCGCUACUGGGGGUCAAA -63
Get sequence