MirGeneDB

MirGeneDB ID

Isc-Mir-3931

Family name MIR-3931 (all species)
Seed ACUUUGA
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-3931
Paralogues
Orthologues
Node of Origin (locus) Ixodes sp.
Node of Origin (family) Ixodes sp.
Genome context
(IscaWI)
DS763086: 296464-296522 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGCCCGUCGAAGACUGCACACUGGAUACGAUUUGUACCGACUCUUGGCUAGGUUUUCGAGAAACUACUUUGAGUCGGUACGAAUCCUUUCCUCUCUGCAUAAACUCCACGGCAAGCC
Get precursor sequence
Structure
        10          20        30        40        50         
GAAGCCCGUCGAAGACU--|  CACU   UAC               UU  C   GUUUU 
                   GCA    GGA   GAUUUGUACCGACUC  GG UAG     C
                   CGU    CCU   CUAAGCAUGGCUGAG  UC AUC     G
CCGAACGGCACCUCAAAUA^  CUCU   UUC               UU  -   AAAGA 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-3931_5p*

MirBase accessionNone
Sequence
0- GAUUUGUACCGACUCUUGGCUAGG -24
Get sequence
Mature sequence

Isc-Mir-3931_3p

MirBase accessionMIMAT0021380
Sequence
36- UACUUUGAGUCGGUACGAAUCCU -59
Get sequence