| MirGeneDB ID | Hru-Mir-2-o55 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Red Abalone (Haliotis rufescens) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Hru-Mir-2-o51 Hru-Mir-2-o52 Hru-Mir-2-o53 Hru-Mir-2-o54 Hru-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | H. rufescens | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_023055435.1_xgHalRufe1.0.p_genomic_plus_traces) |
JALGQA010000019.1: 17033087-17033148 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o55) |
Mir-71
JALGQA010000019.1: 17032907-17032964 [+]
UCSC
Ensembl
Mir-2-o55 JALGQA010000019.1: 17033087-17033148 [+] UCSC Ensembl Mir-2-P12 JALGQA010000019.1: 17033706-17033763 [+] UCSC Ensembl Mir-2-o51 JALGQA010000019.1: 17033823-17033880 [+] UCSC Ensembl Mir-2-o52 JALGQA010000019.1: 17033972-17034029 [+] UCSC Ensembl Mir-2-o53 JALGQA010000019.1: 17034102-17034159 [+] UCSC Ensembl Mir-2-o54 JALGQA010000019.1: 17034273-17034331 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACAGCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UUGAGUGUUGUGAGACUACAGAUGUCAUGCAACGUCAACGCUGGAUGUUAUACUGUGGCUCCAGUCUCUAUCACAGCCAGCCUUGAUGAGCCAUGACACCUGUCAUGACGAGGUCAGCACAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UUGAGUGUUGUGAGACU--| A CAA C A U CUGUGGC ACAG UGUCAUG CGUCAA GCUGG UGU AUA U UGUC ACAGUAC GUAGUU CGACC ACA UAU C AACACGACUGGAGCAGUAC^ C CGA C G C CUCUGAC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Hru-Mir-2-o55_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AACGUCAACGCUGGAUGUUAUA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Hru-Mir-2-o55_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- UCACAGCCAGCCUUGAUGAGCC -62
Get sequence
|
