MirGeneDB ID | Ete-Mir-592 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-592 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Bta-Mir-592 Cfa-Mir-592 Cja-Mir-592 Cpo-Mir-592 Dno-Mir-592 Eca-Mir-592 Hsa-Mir-592 Laf-Mir-592 Mml-Mir-592 Mmr-Mir-592 Mmu-Mir-592 Ocu-Mir-592 Pab-Mir-592 Rno-Mir-592 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (echTel2) |
JH980321: 20252470-20252530 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | UGUGUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AUUUUAAUUUGAUGAUAUUAUGCCAUGACAUUGUGUCAAUAUGCGAUGAUGUGUUGUGAUGACACAGCGUCAUCACGUGGUGACGCAACAUCAUGACGUAAGACAUCACAACGCCAAGCAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AUUUUAAUUUGAUGAUA---| C CA A C GUUGUG UUAUG CAUGA UUGUGUCA UAUG GAUGAUGU A AAUGC GUACU AACGCAGU GUGC CUACUGCG U AACGAACCGCAACACUACAG^ A AC G A ACACAG . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | Mir-592 was classified in Fromm et al. (2015) as a non-canonical miRNA as the Dicer cut is always +3 but given the conservation of the sequence and that it is clearly processed by Drosha it is accepted here as a bona fide miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Ete-Mir-592_5p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- UUGUGUCAAUAUGCGAUGAUGU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Ete-Mir-592_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
39- UCAUCACGUGGUGACGCAACAU -61
Get sequence
|