| MirGeneDB ID | Dno-Mir-592 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-592 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Nine-banded armadillo (Dasypus novemcinctus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-592 Cfa-Mir-592 Cja-Mir-592 Cpo-Mir-592 Eca-Mir-592 Ete-Mir-592 Hsa-Mir-592 Laf-Mir-592 Mml-Mir-592 Mmr-Mir-592 Mmu-Mir-592 Ocu-Mir-592 Pab-Mir-592 Rno-Mir-592 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (dasNov3) |
JH570472: 1253795-1253855 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGUGUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AAUUUAAUUUGAUGAUAUUAUGCCAUGGCAUUGUGUCAAUAUGCGAUGAUGUGUUGUGAUGGCACAGCGUCAUCACGUGGUGACGCAACAUCAUGACGUAAAACAUCACAACGCCCAUUAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AAUUUAAUUUGAUGAUA---| C CA A C GUUGUG UUAUG CAUGG UUGUGUCA UAUG GAUGAUGU A AAUGC GUACU AACGCAGU GUGC CUACUGCG U AAUUACCCGCAACACUACAA^ A AC G A ACACGG . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Mir-592 was classified in Fromm et al. (2015) as a non-canonical miRNA as the Dicer cut is always +3 but given the conservation of the sequence and that it is clearly processed by Drosha it is accepted here as a bona fide miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dno-Mir-592_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUGUGUCAAUAUGCGAUGAUGU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dno-Mir-592_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- UCAUCACGUGGUGACGCAACAU -61
Get sequence
|
