MirGeneDB ID | Eba-Mir-2-o90 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Epimenia (Solenogaster) (Epimenia babai) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Eba-Mir-2-o91 Eba-Mir-2-o92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | E. babai | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_011762755.2_ASM1176275v2_Epimenia) |
WURV02085510.1: 1105-1165 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-2-o90) |
Mir-2-o90
WURV02085510.1: 1105-1165 [+]
Ensembl
Mir-2-o91 WURV02085510.1: 2691-2749 [+] Ensembl Mir-2-o92 WURV02085510.1: 3976-4035 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AUUUAUGAUGACUCGAGCAUUCCUGGUGGAUCGUCAAAGUUUCUGUGAAAUGUGUCAUAUAUUCAUCAUAUCACAGUCAGCUUUGACGAGCCUCCGUGGGUGUCCAAUCAGCCGCCUCACAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AUUUAUGAUGACUCGAG-- C U A U-| A UGUCAU CAUUC UGG GG UCGUCAAAGUU CUGUGA AUG A GUGGG GCC CC AGCAGUUUCGA GACACU UAC U ACACUCCGCCGACUAACCU U U G CU^ A UACUUA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Eba-Mir-2-o90_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- UCGUCAAAGUUUCUGUGAAAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Eba-Mir-2-o90_3p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
38- UAUCACAGUCAGCUUUGACGAGC -61
Get sequence
|