MirGeneDB ID | Eba-Mir-2-o90 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-2 (all species) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Epimenia (Solenogaster) (Epimenia babai) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Eba-Mir-2-o91 Eba-Mir-2-o92 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Gsp-Mir-2 Ple-Mir-2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | E. babai | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_011762755.2_ASM1176275v2_Epimenia) |
WURV02085510.1: 1105-1165 [+] Ensembl | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-2-o90) |
Mir-2-o90
WURV02085510.1: 1105-1165 [+]
Ensembl
Mir-2-o91 WURV02085510.1: 2691-2749 [+] Ensembl Mir-2-o92 WURV02085510.1: 3976-4035 [+] Ensembl |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUCACAG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AUUUAUGAUGACUCGAGCAUUCCUGGUGGAUCGUCAAAGUUUCUGUGAAAUGUGUCAUAUAUUCAUCAUAUCACAGUCAGCUUUGACGAGCCUCCGUGGGUGUCCAAUCAGCCGCCUCACAGet precursor sequence |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AUUUAUGAUGACUCGAG-- C U A U-| A UGUCAU CAUUC UGG GG UCGUCAAAGUU CUGUGA AUG A GUGGG GCC CC AGCAGUUUCGA GACACU UAC U ACACUCCGCCGACUAACCU U U G CU^ A UACUUA . 110 100 90 80 70 60 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17), UGUG in loop | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Eba-Mir-2-o90_5p* (predicted) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- UCGUCAAAGUUUCUGUGAAAUG -22
Get sequence
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Eba-Mir-2-o90_3p (predicted) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
38- UAUCACAGUCAGCUUUGACGAGC -61
Get sequence
|