MirGeneDB

MirGeneDB ID

Dme-Mir-976

Family name MIR-976 (all species)
Seed UGGAUUA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-976
Paralogues
Orthologues Dan-Mir-976  Dmo-Mir-976 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(dm6)
chrX: 19558917-19558975 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-976)
Mir-972 chrX: 19551171-19551226 [+] UCSC Ensembl
Mir-973 chrX: 19551546-19551611 [+] UCSC Ensembl
Mir-974 chrX: 19551702-19551763 [+] UCSC Ensembl
Mir-2499 chrX: 19557029-19557090 [+] UCSC Ensembl
Mir-975 chrX: 19558768-19558828 [+] UCSC Ensembl
Mir-976 chrX: 19558917-19558975 [+] UCSC Ensembl
Mir-977 chrX: 19559046-19559108 [+] UCSC Ensembl
Mir-978-v1 chrX: 19561251-19561313 [+] UCSC Ensembl
Mir-978-v2 chrX: 19561252-19561312 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGGUGGGCAUCGCCAUGCAGUGCCGCGGCAUUGGUGAGGCCAUCUCCAAUGGAUUAGUUCUCAACAUUGGAUUAGUUAUCAUCAAUGCCGGUGCACUGCACCUAACAACAUCGCGCCG
Get precursor sequence
Structure
        10          20        30        40        50         
GUGGUGGGCAUCGCCAU--|      CG            GGCCAUC       GAUUAG 
                   GCAGUGC  CGGCAUUGGUGA       UCCAAUG      \
                   CGUCACG  GCCGUAACUACU       AGGUUAC      U
GCCGCGCUACAACAAUCCA^      UG            AUUGAUU       AACUCU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-976_5p*

MirBase accessionMIMAT0020873
Sequence
0- AUUGGUGAGGCCAUCUCCAAUG -22
Get sequence
Mature sequence

Dme-Mir-976_3p

MirBase accessionMIMAT0005492
Sequence
37- UUGGAUUAGUUAUCAUCAAUGC -59
Get sequence
Validated targets microrna.org: MIMAT0005492
TargetScanFly: dme-miR-976