MirGeneDB

MirGeneDB ID

Dan-Mir-989

Family name MIR-989 (all species)
Seed GUGAUGU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-989  Dme-Mir-989  Dmo-Mir-989  Hme-Mir-989-P1  Hme-Mir-989-P2  Tca-Mir-989 
Node of Origin (locus) Endopterygota
Node of Origin (family) Endopterygota
Genome context
(Dana_caf1)
scaffold_13266: 5886572-5886705 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAAAAAAGAAACCAACGUUUCGGGAAGUGGCCACUACCUCGCAGUCACGUGAUGCCAAAAUGCAACUGACACUGAUCCGGAGAUGGUCCUCCAUCCUUGGGAUUAGUGUUAAUUUGUGUUUUUUUUAUUUGAAUAGUUCAUGUGAUGUGACGUAGUGGAACAUUCCUGGCGUUCCUAACAACAAAAAGUGAC
Get precursor sequence
Structure
        10            20         30        40        50        60        70        80        90       
AAAAAAAAAGAAACCAA----|  UU      -  GG       C     G       AUGCCAAAAUGCAACUGACACUGAUCCGGAGAUGGUCCUCCAU 
                     CGU  CGGGAA GU  CCACUAC UCGCA UCACGUG                                           \
                     GCG  GUCCUU CA  GGUGAUG AGUGU AGUGUAC                                           C
CAGUGAAAAACAACAAUCCUU^  --      A  A-       C     -       UUGAUAAGUUUAUUUUUUUUGUGUUUAAUUGUGAUUAGGGUUC 
  190       180         170        160       150        140       130       120       110       100
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-989_5p* (predicted)

MirBase accessionNone
Sequence
0- GGCCACUACCUCGCAGUCACGUG -23
Get sequence
Mature sequence

Dan-Mir-989_3p

MirBase accessionNone
Sequence
112- UGUGAUGUGACGUAGUGGAACA -134
Get sequence