MirGeneDB

MirGeneDB ID

Dan-Mir-988

Family name MIR-988 (all species)
Seed CCCUUGU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-988  Dme-Mir-988  Dmo-Mir-988  Hme-Mir-988 
Node of Origin (locus) Diptera plus Lepidoptera
Node of Origin (family) Diptera plus Lepidoptera
Genome context
(Dana_caf1)
scaffold_13266: 2579731-2579788 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGUGGAAAGGUGUACUGGACAUUUUGGGUGUGUGAUUUGUGGCAAAGUGAUAGGUAUUUGAUCAUCCCCUUGUUGCAAACCUCACGCCCAAGGUGCUUUCCAACGGCAACAUAUCAG
Get precursor sequence
Structure
        10           20        30        40        50        
AAGUGGAAAGGUGUACU---| A             UGA    UG    AGU   AGGUA 
                    GG CAUUUUGGGUGUG   UUUG  GCAA   GAU     U
                    UC GUGGAACCCGCAC   AAAC  UGUU   CUA     U
GACUAUACAACGGCAACCUU^ -             UCC    GU    CCC   CUAGU 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-988_5p*

MirBase accessionNone
Sequence
0- GUGUGAUUUGUGGCAAAGUGAU -22
Get sequence
Mature sequence

Dan-Mir-988_3p

MirBase accessionNone
Sequence
36- CCCCUUGUUGCAAACCUCACGC -58
Get sequence