MirGeneDB

MirGeneDB ID

Dan-Mir-971

Family name MIR-971 (all species)
Seed UGGUGUU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-971  Bge-Mir-971-v1  Bge-Mir-971-v2  Dme-Mir-971  Dmo-Mir-971  Hme-Mir-971  Tca-Mir-971 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(Dana_caf1)
scaffold_13117: 3891818-3891881 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGUGAGAAAAUUCCGUGGCUGGCAUCGUUCACUGUAAAUUGUAACCAUCAAAGCGUUUUUUAUCAGAGCCGCUUGGUGUUACUUCUUACAGUGAGUGAGCCAGCUGGAGCACAUAUUAAAAAAA
Get precursor sequence
Structure
        10           20        30        40        50        60  
UGUGAGAAAAUUCCGUG---|     A             AUU     C     A  GUUUUUU 
                    GCUGGC UCGUUCACUGUAA   GUAAC AUCAA GC       A
                    CGACCG AGUGAGUGACAUU   CAUUG UGGUU CG       U
AAAAAAAUUAUACACGAGGU^     -             CUU     -     -  CCGAGAC 
  120       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-971_5p*

MirBase accessionNone
Sequence
0- ACUGUAAAUUGUAACCAUCAAAGC -24
Get sequence
Mature sequence

Dan-Mir-971_3p

MirBase accessionNone
Sequence
42- UUGGUGUUACUUCUUACAGUGA -64
Get sequence